Data Science Research in Biology -
Fall 2022

A course for UC Merced undergraduates in data science applications for research in ecology and evolution

Creative Commons License

DNA or RNA Iteration


  1. Write a function with the form dna_or_rna(sequence), that determines if a sequence of base pairs is DNA, RNA, or if it is not possible to tell given the sequence provided. Since all the function will know about the material is the sequence as character vector, the only way to tell the difference between DNA and RNA is that RNA has the base Uracil ("u") instead of the base Thymine ("t"). Have the function return one of three outputs: "DNA", "RNA", or "UNKNOWN".

  2. Create the following vector of sequences; use the function you created in (1) and a for loop to print the type of each element in the vector sequences:

sequences = c("ttgaatgccttacaactgatcattacacaggcggcatgaagcaaaaatatactgtgaaccaatgcaggcg", "gauuauuccccacaaagggagugggauuaggagcugcaucauuuacaagagcagaauguuucaaaugcau", "gaaagcaagaaaaggcaggcgaggaagggaagaagggggggaaacc", "guuuccuacaguauuugaugagaaugagaguuuacuccuggaagauaauauuagaauguuuacaacugcaccugaucagguggauaaggaagaugaagacu", "gauaaggaagaugaagacuuucaggaaucuaauaaaaugcacuccaugaauggauucauguaugggaaucagccggguc")

  1. Use the function you created in (1) and sapply() to print the type of the sequences in the vector sequences that you created in (2).

  2. Explain what is the main difference between a for loop and an sapply function; elaborate.

  3. Optional: For a little extra challenge make your function work with both upper and lower case letters, or even strings with mixed capitalization.